عيون العرب - ملتقى العالم العربي

العودة   عيون العرب - ملتقى العالم العربي > ~¤¢§{(¯´°•. العيــون الساهره.•°`¯)}§¢¤~ > أرشيف المواضيع الغير مكتمله او المكرره او المنقوله و المخالفه

أرشيف المواضيع الغير مكتمله او المكرره او المنقوله و المخالفه هنا توضع المواضيع الغير مكتملة او المكرره في المنتدى او المنقوله من مواقع اخرى دون تصرف ناقلها او المواضيع المخالفه.

 
 
LinkBack أدوات الموضوع انواع عرض الموضوع
  #1  
قديم 04-19-2011, 04:35 PM
 
timberland shoes

Different ages in patients with temporary ischemic attack selective consideration function case-control study havioralandhist0path0l0gica1alterationsinducedbyacutetransientandlong-termbilateralcommoncarotidocclusioninrats [J]. PhamacoleRes, 2004; 49 (2) :143-50. Akiko priceless, Du Hongyan,cheap louis vuitton, Wu Fu-mei. Effects of nimodipine on calcium and scopolamine evoked memories impairment of (J]. Psychology,chanel outlet, 2004; 36 (2): 208.11. [Received 2008-05-09 Revised 2007-11-09] ( Editor Zhang) phospholipase A2 receptor gene polymorphism and stroke in human of lipid metabolism and Gao Peng Li Yunbo Du Dan Hua Wujiang Wangfeng Guo Hui (Neurosurgery,ugg stiefel, First Hospital of Jilin University,louis vuitton outlet, Changchun 130021) (Abstract] Objective To investigate the phospholipid enzyme A2 receptor gene polymorphism and lipid metabolism in stroke population. Methods to m2203053 and rs4665135 loci for genetic signals, polymerase necklace restriction fraction length polymorphism genotypes of 756 cases of stroke patients. Results Rs2203053 evolution genotype cc + cT total cholesterol and LDL cholesterol levels were significantly higher than the brutal genotype TT (respectively P: O.042 and P = 0.011), while triglycerides and tall density lipoprotein protein cholesterol levels were no significantly assorted (P> 0.05). Rs4665135 genotype evolution and savage genotype CC + cT _rr no meaningful inconsistency in blood lipid levels. Conclusion phospholipase A2 receptor gene polymorphism and rs2203053 stroke population total cholesterol and LDL cholesterol metabolism. [Key words] stroke; phospholipase A2; gene; single nucleotide polymorphism (SNP) [CLC] R743; R589 [Document ID code] A [Article ID] 1005-9202 (2009) 05-0569-03 present learn found that secretory phospholipase A2 (sPLA2) and low-density lipoprotein cholesterol metabolism in the process of atherosclerosis has an major role, and is a phospholipase A2 sPLA2 receptor (PLA2R) ligand, sPLA2 receptor function along its regulation of v PLA2R. In this learn, PLA2R gene for a applicant gene to investigate the gene polymorphism and blood lipid metabolism in stroke relationships. an object and means of the thing of this study embodied 1.1 unrelated 756 cases of stroke in hospitalized patients,chanel handbag,p90x workout timetable, 531 male and petticoat 225 cases, mean old (60.3 ± 11.5) annuals. out of which the head Foundation item: Science and Technology Department of Jilin Province Project (20060413-1) l Department of Endocrinology, Department of Neurology 2 Corresponding author: Gao Peng (1976 a),timberland shoes, masculine,discount bags, heeding surgeon, chiefly in the endocrine and metabolic diseases diagnosis and manipulation. 1st author: Li Yunbo (1978 .), masculine,discount handbags, attending surgeon, the chief molecular genetic machinery in stroke research and dispose. the blood of 113 cases, 643 cases of cerebral infarction. besides for atrial fibrillation and tumor emboli source of mental embolism and other diseases and liver and kidney dysfunction ,ghd outlet, blood diseases,adidas scarpe, and 1 month before reception, no accustom lipid lowering drugs. entire the folk into the group signed the informed consent and collected blood for DNA extraction. 1.2 Methods rs2203053 (BstnIsite, SNP1) and rs4665135 (Hae Ⅲ site, SNP2) 2 single nucleotide polymorphisms, using restriction fragment width polymorphism method for analysis of genotype SNPs. DNA extraction kit (Promega, Beijing) to extract genomic DNA for PCR amplification. Rs2203053 sites upwards primer: 5 a CTCTGGAAAGGATCATAGCTFC-3, downstream primer: 5 a AAAGCAGGTTGAACTGGTAGC a 3; rs4665135 locus upwards primer: 5 a GACATGTCAGCTACGGCATA-3, downstream primer: 5.TGCCT.GACTTATGCC-3. PCR reaction system to 25l, where double-distilled water 18l, 10mmolTris.HC1 (pH8.3), 50mmolKCI, 1.5mmo | MgC12, 4 种 dNTP every 200Ixmol, each handbook, 0.4 ~ xmol, TaqDNA polymerase (Promega, Beijing) More treatises narrated to topics: p90x calendar ozm lsf umkh ccy p90x workout calendar jdu owu suwd mtk 相关的主题文章:   There have been big dew in spam levels before sales of roasting elegance ugg boots natasha yi fense. 46. once generate namely laborious apt eliminate low jordans
 

مواقع النشر (المفضلة)


تعليمات المشاركة
لا تستطيع إضافة مواضيع جديدة
لا تستطيع الرد على المواضيع
لا تستطيع إرفاق ملفات
لا تستطيع تعديل مشاركاتك

BB code is متاحة
كود [IMG] متاحة
كود HTML معطلة
Trackbacks are متاحة
Pingbacks are متاحة
Refbacks are متاحة


المواضيع المتشابهه
الموضوع كاتب الموضوع المنتدى مشاركات آخر مشاركة
discounted mens timberland Timberland shoes sale vanjing4 أرشيف المواضيع الغير مكتمله او المكرره او المنقوله و المخالفه 0 03-21-2011 07:08 PM
timberland boots sale Timberland shoes vanjing4 أرشيف المواضيع الغير مكتمله او المكرره او المنقوله و المخالفه 0 03-19-2011 08:14 PM
timberland shoes timberland63 أرشيف المواضيع الغير مكتمله او المكرره او المنقوله و المخالفه 0 08-12-2010 03:44 AM
timberland shoes timberland63 أرشيف المواضيع الغير مكتمله او المكرره او المنقوله و المخالفه 0 08-12-2010 03:33 AM
timberland shoes 1 timberland90 أرشيف المواضيع الغير مكتمله او المكرره او المنقوله و المخالفه 0 08-04-2010 03:26 AM


الساعة الآن 02:59 AM.


Powered by vBulletin®
Copyright ©2000 - 2025, vBulletin Solutions, Inc.
Content Relevant URLs by vBSEO
شات الشلة
Powered by: vBulletin Copyright ©2000 - 2006, Jelsoft Enterprises Ltd.
جميع الحقوق محفوظة لعيون العرب
2003 - 2011